Alternative yeast nuclear code

The alternative yeast nuclear code (translation table 12) is a genetic code found in certain yeasts. However, other yeast, including Saccharomyces cerevisiae, Candida azyma, Candida diversa, Candida magnoliae, Candida rugopelliculosa, Yarrowia lipolytica, and Zygoascus hellenicus, definitely use the standard (nuclear) code.^[1]

The code

   AAs = FFLLSSSSYY**CC*WLLLSPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = -------------------M---------------M----------------------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).

Differences from the standard code

DNA codons	RNA codons	This code (12)		Standard code (1)
CTG	CUG	Ser (S)		Leu (L)

Alternative initiation codons

• CAG may be used in Candida albicans.^[2]

Systematic range

• Endomycetales (yeasts): Candida albicans, Candida cylindracea, Candida melibiosica, Candida parapsilosis, and Candida rugosa.^[1]

See also

• List of genetic codes