Top Qs
Timeline
Chat
Perspective

Ascidian mitochondrial code

Mitochondrial genetic code in tunicates From Wikipedia, the free encyclopedia

Remove ads

The ascidian mitochondrial code (translation table 13) is a genetic code found in the mitochondria of Ascidia.

Code

   AAs = FFLLSSSSYY**CCWWLLLLPPPPHHQQRRRRIIMMTTTTNNKKSSGGVVVVAAAADDEEGGGG
Starts = ---M------------------------------MM---------------M------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Remove ads

Differences from the standard code

More information DNA codons, RNA codons ...

Systematic range and comments

There is evidence from a phylogenetically diverse sample of tunicates (Urochordata) that AGA and AGG code for glycine. In other organisms, AGA/AGG code for either arginine or serine and in vertebrate mitochondria they code a STOP. Evidence for glycine translation of AGA/AGG was first found in 1993 in Pyura stolonifera[1] and Halocynthia roretzi.[2] It was then confirmed by tRNA sequencing[3] and sequencing whole mitochondrial genomes.[4][5]

Alternative initiation codons

See also

References

Loading related searches...

Wikiwand - on

Seamless Wikipedia browsing. On steroids.

Remove ads