Top Qs
Timeline
Chat
Perspective
Blastocrithidia nuclear code
Nuclear genetic code in some flagellates From Wikipedia, the free encyclopedia
Remove ads
The Blastocrithidia nuclear code (translation table 31) is a genetic code used by the nuclear genome of the trypanosomatid genus Blastocrithidia.[1] This code, along with translation tables 27 and 28, is remarkable in that every one of the 64 possible codons can be a sense codon.[1]
The code (31)
AAs = FFLLSSSSYYEECCWWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = ----------**-----------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Remove ads
Differences from the standard code
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 33.
- The genetic codes database.
References
Wikiwand - on
Seamless Wikipedia browsing. On steroids.
Remove ads