Top Qs
Timeline
Chat
Perspective
Ciliate, dasycladacean and hexamita nuclear code
Alternative genetic code From Wikipedia, the free encyclopedia
Remove ads
The ciliate, dasycladacean and Hexamita nuclear code (translation table 6) is a genetic code used by certain ciliate, dasycladacean and Hexamita species.
The ciliate macronuclear code has not been determined completely. The codon UAA is known to code for Gln only in the Oxytrichidae.
The code
AAs = FFLLSSSSYYQQCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = -----------------------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V).
Remove ads
Differences from the standard code
Systematic range
- Ciliata: Oxytricha and Stylonychia,[1] Paramecium, Tetrahymena, Oxytrichidae and probably Glaucoma chattoni.
- Dasycladaceae: Acetabularia,[2] and Batophora.[3]
- Diplomonadida: Hexamita inflata, Diplomonadida ATCC50330, and ATCC50380.
See also
References
External links
Wikiwand - on
Seamless Wikipedia browsing. On steroids.
Remove ads