Top Qs
Timeline
Chat
Perspective

Euplotid nuclear code

An alternative genetic code found in the nuclear genome of some spirotrich ciliates From Wikipedia, the free encyclopedia

Remove ads

The euplotid nuclear code (translation table 10) is the genetic code used by Euplotidae. The euplotid code is a socalled "symmetrical code", which results from the symmetrical distribution of the codons. This symmetry allows for arythmic exploration of the codon distribution. In 2013, shCherbak and Makukov, reported that "the patterns are shown to match the criteria of an intelligent signal."[1]

Remove ads

The code

   AAs = FFLLSSSSYY**CCCWLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG
Starts = -----------------------------------M----------------------------
 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG
 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG
 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Remove ads

Differences from the standard code

More information DNA codons, RNA codons ...

Systematic range

See also

References

Loading content...
Loading related searches...

Wikiwand - on

Seamless Wikipedia browsing. On steroids.

Remove ads