Top Qs
Timeline
Chat
Perspective
Karyorelict nuclear code
Nuclear genetic code in some ciliates From Wikipedia, the free encyclopedia
Remove ads
The karyorelictid nuclear code (translation table 27) is a genetic code used by the nuclear genome of the Karyorelictea ciliate Parduczia sp.[1] This code, along with translation tables 28 and 31, is remarkable in that every one of the 64 possible codons can be a sense codon. Translation termination probably relies on context, specifically proximity to the poly(A) tail.[2]
The code (27)
AAs = FFLLSSSSYYQQCCWWLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Remove ads
Differences from the standard code
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
Wikiwand - on
Seamless Wikipedia browsing. On steroids.
Remove ads