Top Qs
Timeline
Chat
Perspective
Peritrich nuclear code
Nuclear genetic code in some ciliates From Wikipedia, the free encyclopedia
Remove ads
The peritrich nuclear code (translation table 30) is a genetic code used by the nuclear genome of the peritrich ciliates Vorticella and Opisthonecta.[1]
The code (30)
AAs = FFLLSSSSYYEECC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------*--------------------M----------------------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), and Valine (Val, V).
Remove ads
Differences from the standard code
See also
- List of all genetic codes: translation tables 1 to 16, and 21 to 31.
- The genetic codes database.
References
Wikiwand - on
Seamless Wikipedia browsing. On steroids.
Remove ads