Scenedesmus obliquus mitochondrial code

The Scenedesmus obliquus mitochondrial code (translation table 22) is a genetic code found in the mitochondria of Scenedesmus obliquus, a species of green algae.^[1]

Code

   AAs = FFLLSS*SYY*LCC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = -----------------------------------M----------------------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code

DNA codons	RNA codons	This code (22)		Standard code (1)
TCA	UCA	STOP = Ter (*)		Ser (S)
TAG	UAG	Leu (L)		STOP = Ter (*)

Systematic range and comments

• Scenedesmus obliquus ^[1]

See also

• List of genetic codes