Thraustochytrium mitochondrial code

The Thraustochytrium mitochondrial code (translation table 23) is a genetic code found in the mitochondria of the labyrinthulid protist Thraustochytrium aureum.^[1] The mitochondrial genome was sequenced by the Organelle Genome Megasequencing Program.

Code

   AAs = FF*LSSSSYY**CC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG

Starts = --------------------------------M--M---------------M------------

 Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG

 Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG

 Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG

Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).

Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)

Differences from the standard code

It is the similar to the bacterial code (translation table 11) but it contains an additional stop codon (TTA) and also has a different set of start codons.

DNA codons	RNA codons	This code (23)		Standard code (1)
TTA	UUA	STOP = Ter (*)		Leu (L)

Systematic range and comments

• Mitochondria of Thraustochytrium aureum.

See also

• List of genetic codes