KIAA1797

KIAA1797 is a protein that in humans is encoded by the KIAA1797 gene.^[5]

FOCAD
Identifiers
Aliases	FOCAD, KIAA1797, focadhesin
External IDs	OMIM: 614606; MGI: 2676921; HomoloGene: 9842; GeneCards: FOCAD; OMA:FOCAD - orthologs
Gene location (Human) Chr. Chromosome 9 (human)[1] Band 9p21.3 Start 20,658,309 bp[1] End 20,995,955 bp[1]
Gene location (Mouse) Chr. Chromosome 4 (mouse)[2] Band 4|4 C4 Start 88,094,629 bp[2] End 88,411,011 bp[2]
RNA expression pattern Bgee Human Mouse (ortholog) Top expressed in Epithelium of choroid plexus middle temporal gyrus parotid gland Brodmann area 23 epithelium of bronchus bronchial epithelial cell epithelium of colon islet of Langerhans endothelial cell pituitary gland Top expressed in zygote facial motor nucleus granulocyte primary oocyte gastrula superior frontal gyrus lateral septal nucleus spermatocyte spermatid secondary oocyte More reference expression data BioGPS n/a
Orthologs Species Human Mouse Entrez 54914 230393 Ensembl ENSG00000188352 ENSMUSG00000038368 UniProt Q5VW36 A2AKG8 RefSeq (mRNA) NM_017794 NM_001375567 NM_001375568 NM_001375570 NM_001081184 RefSeq (protein) NP_060264 NP_001362496 NP_001362497 NP_001362499 NP_001074653 Location (UCSC) Chr 9: 20.66 – 21 Mb Chr 4: 88.09 – 88.41 Mb PubMed search [3] [4]
Wikidata
View/Edit Human View/Edit Mouse

A specific single-nucleotide polymorphism rs7875153 in KIAA1797 is associated with heart rate.^[6]

Gene

KIAA1797 is a protein-coding gene in Homo sapiens. Alternate names for the gene are FLJ20375, OTTHUMP00000069845, and hypothetical protein LOC54914.^[5] Located on chromosome 9 at area p21.3,^[7] the entire gene including introns and exons is 375,010 base pairs on the plus strand. There are 19 alternative splice variants. Longest variant yields an mRNA of 6117 base pairs.

Expression

KIAA1797 was determined to express ubiquitously at varying levels throughout the human body. Based on the EST profile of Unigene, KIAA1797 expression has been observed in tissues ranging from reproductive to secretory.^[8]

mRNA

Predicted secondary mRNA structures in the 5'UTR and the 3'UTR are ugagaugaacucgguaucuca and uccuaagagaggag, respectively. Other possible secondary structures are shown in the table below.

Protein sequence

The main isoform of the human protein is 1801 amino acids long, a total of 200,072 Da.^[7]

Two distinct domains of unknown function (DUF) are found in the sequence. DUF3730 (465-682aa) appears two times in the sequence; this domain family is found in eukaryotes and is typically between 220 and 262 amino acids in length. DUF3028(1213-1801aa). No additional information was available regarding this DUF.

Homology

KIAA1797 is well conserved in mammals, but it is also found in nonmammalians with lower sequence identities.

Ort of KIAA1797

Gene neighborhood

KIAA1797 is downstream of MLLT3 and upstream of PTPLAD2. MLLT3 is involved with myeloid/lymphoid or mixed-lineage leukemia. PTPLAD2 is a protein tyrosine phosphatase.

Function

The exact function of KIAA1797 is not yet understood by the scientific community. It is, however, found to be a transmembrane protein.